• Creator: guest98
• Population: 0
• Generation: 3
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 05/19/2019
• Genome: CGAATCATAGTCAGCAGTCCTAGGTCCACCGCT
• Function:

  mod(band pass(logn(gradient[1](numbers('xyy')) if numbers('xyy') > numbers('yxr') else cos(gradient[1](numbers('xyy'))))), logn(numbers('xyy') if gradient[1](numbers('xyy')) > numbers('yxr') else cos(gradient[1](numbers('xyy')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.