• Creator: VanityMatrix
• Population: 0
• Generation: 0
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 05/19/2019
• Genome: CTATTCGCCACGACCCGCTGATGAGAGAAG
• Function:

  max(10 *(numbers('xry')) if 100 *(10 *(numbers('xry'))) > numbers('xry') if 10 *(numbers('xry')) > 100 *(10 *(numbers('xry'))) else numbers("xxr") else numbers('xry'), 10 *(numbers('xry')) if numbers('xry') > numbers("xxr") else 100 *(10 *(numbers('xry'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.