header

genetic-algorithms.com

 

Inspect VanityMatrix_0_1_18

Parents

Mother

Image 01

VanityMatrix_0_0_15

Genome: CTCTAATCTAGCGTGTTACGATTGATCTCT

Father

Image 01

VanityMatrix_0_0_12

Genome: CTATTCGCCACGACCCGCTGATGAGAGAAG

VanityMatrix_0_1_18

Image 01

  • Creator: VanityMatrix
  • Population: 0
  • Generation: 1
  • Total Fitness: 4
  • No. Votes: 1
  • Avg. Fitness 4
  • Created: 05/19/2019
  • Genome: CTCTAATCTAGCCCCCTACGATTTATCTCT
  • Function:

    min(numbers("per") if cos(product(numbers("per"), numbers("xxr"))) > numbers("per") if numbers("xxr") > product(numbers("per"), numbers("xxr")) else cos(product(numbers("per"), numbers("xxr"))) else product(numbers("per"), numbers("xxr")), cos(product(numbers("per"), numbers("xxr"))) if product(numbers("per"), numbers("xxr")) > numbers("per") else numbers("xxr"))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

VanityMatrix_0_1_18 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!