• Creator: guest105
• Population: 0
• Generation: 0
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 05/19/2019
• Genome: CCAGAGGGGAGTCGGAAGGCGCTGAAAAGG
• Function:

  product(numbers("xyx") if exp(numbers("xyx"), numbers('yxy')) > exp(numbers("xyx"), numbers('yxy')) if numbers('yxy') > gradient[1](exp(numbers("xyx"), numbers('yxy'))) else numbers("xyx") else gradient[1](exp(numbers("xyx"), numbers('yxy'))), exp(numbers("xyx"), numbers('yxy')) if numbers("xyx") > numbers('yxy') else gradient[1](exp(numbers("xyx"), numbers('yxy'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.