• Creator: guest105
• Population: 0
• Generation: 1
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 05/19/2019
• Genome: TAGAGGGGGAGTCGGAAGGGCTGGCGCGAG
• Function:

  exp(numbers("xyx"), numbers('xry')) if tan(gradient[1](exp(numbers("xyx"), numbers('xry'))) if numbers('xry') > numbers("xyx") else exp(numbers("xyx"), numbers('xry'))) > numbers("xyx") if exp(numbers("xyx"), numbers('xry')) > numbers('xry') else gradient[1](exp(numbers("xyx"), numbers('xry'))) else gradient[1](exp(numbers("xyx"), numbers('xry')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.