header

genetic-algorithms.com

 

Inspect global_global_0_0_5

Parents

global_global_0_0_5 has no parents. It was generated at random.

global_global_0_0_5

Image 01

  • Creator: global
  • Population: 0 (Global)
  • Generation: 0
  • Total Fitness: 35
  • No. Votes: 5
  • Avg. Fitness 7
  • Created: 05/19/2019
  • Genome: GATAAACACTTCCCCACCTATCATGGGACT
  • Function:

    product(numbers('yyx'), numbers("yxx")) if numbers("yxx") > numbers('yyx') else numbers("yxx") if abs(sum(numbers("yxx") if product(numbers('yyx'), numbers("yxx")) > numbers('yyx') else numbers("yxx"), product(numbers('yyx'), numbers("yxx")))) > product(numbers('yyx'), numbers("yxx")) else sum(numbers("yxx") if numbers("yxx") > product(numbers('yyx'), numbers("yxx")) else numbers('yyx'), product(numbers('yyx'), numbers("yxx")))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest30_0_1_55

Image 01

Genome: TTCGTTTTCCAAACTTTATATCATGGGAGT

sina12345_0_1_216

Image 01

Genome: GGTGATAAACACTTGCCCACCTATCATGGGACT

guest94_0_1_276

Image 01

Genome: CTTGATAAACACTTCCCCTTATATCATGGGACT

guest195_0_1_289

Image 01

Genome: GATAAACACTTCCCCGCCTTAACTGGGACC

guest200_0_1_335

Image 01

Genome: GGCGATATAAACTCCCCCACCTATCATGGGACT

sina12345_0_1_200

Image 01

Genome: CCATTATCAAGCCCCACCCGGCATTGTCCT

guest195_0_1_308

Image 01

Genome: TCCCTAGAAAACACCGGTTTAACGCGGCATAGT