header

genetic-algorithms.com

 

Inspect sina12345_global_0_1_200

Parents

Mother

Image 01

global_global_0_0_50

Genome: CGATTATAAACTAGACCTCGGCATTGTCCT

Father

Image 01

global_global_0_0_5

Genome: GATAAACACTTCCCCACCTATCATGGGACT

sina12345_global_0_1_200

Image 01

  • Creator: sina12345
  • Population: 0 (Global)
  • Generation: 1
  • Total Fitness: 13
  • No. Votes: 3
  • Avg. Fitness 4.3
  • Created: 05/19/2019
  • Genome: CCATTATCAAGCCCCACCCGGCATTGTCCT
  • Function:

    product(product(numbers('yyx'), numbers('yxr')) if cos(product(numbers('yyx'), numbers('yxr'))) if numbers('yyx') > product(numbers('yyx'), numbers('yxr')) else numbers('yxr') > cos(product(numbers('yyx'), numbers('yxr'))) else numbers('yyx'), numbers('yyx') if product(numbers('yyx'), numbers('yxr')) > numbers('yxr') else cos(product(numbers('yyx'), numbers('yxr'))))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest75_0_2_128

Image 01

Genome: CTACCATTATCAATGTGTCGGGCCGTTTGTCCT

guest94_0_2_151

Image 01

Genome: CGTCCATTATCAAGCCCCAAAACTACGGACCCTGAT

guest195_0_2_192

Image 01

Genome: CCATCATCGAACCCCACCCGGCATTGTCCT

guest203_0_2_241

Image 01

Genome: CCTTGAGCAAACCCCACGTCTCACCGACCT

guest195_0_2_187

Image 01

Genome: GATTTTTGGCGAGCCGCCCCCGTATGATGTTCA

guest8200_0_2_265

Image 01

Genome: CTTGTAAACAGCGAGTCTAAGCGGCAGTGT