header

genetic-algorithms.com

 

Inspect global_global_0_0_59

Parents

global_global_0_0_59 has no parents. It was generated at random.

global_global_0_0_59

Image 01

  • Creator: global
  • Population: 0 (Global)
  • Generation: 0
  • Total Fitness: 36
  • No. Votes: 4
  • Avg. Fitness 9
  • Created: 05/19/2019
  • Genome: TATCTATAGCCTCTATACATTTCGTAGACT
  • Function:

    max(max(numbers("xxy"), numbers('rrr')) if divide(max(numbers("xxy"), numbers('rrr')), numbers("xxy")) > numbers("xxy") else numbers('rrr'), divide(max(numbers("xxy"), numbers('rrr')), numbers("xxy"))) if max(numbers("xxy"), numbers('rrr')) > divide(max(numbers("xxy"), numbers('rrr')), numbers("xxy")) else numbers("xxy") if max(numbers("xxy"), numbers('rrr')) > numbers('rrr') else divide(max(numbers("xxy"), numbers('rrr')), numbers("xxy"))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest75_0_1_274

Image 01

Genome: TCGTATCTATACCCTCCGTAAACAACAACTACT

sina12345_0_1_219

Image 01

Genome: GTATATCTATAGTTCCATTACATTTCGTAGACT

sina12345_0_1_146

Image 01

Genome: TACTATCTATAGCCTCTATACATTTGGTAGACG

guest75_0_1_261

Image 01

Genome: TCTCGATTATAATCTAGACCGCGGTCCTGTCCT

guest75_0_1_258

Image 01

Genome: GTAACATTAGTTGAGTCCCCCATTTCGGTTACA

sina12345_0_1_228

Image 01

Genome: CATTTCAAAATATCACTCTACATCGCATTACGG

sina12345_0_1_189

Image 01

Genome: TTGGCAGCACATCTTCTATCGCACGAGGTACTG