header

genetic-algorithms.com

 

Inspect guest75_global_0_1_261

Parents

Mother

Image 01

global_global_0_0_50

Genome: CGATTATAAACTAGACCTCGGCATTGTCCT

Father

Image 01

global_global_0_0_59

Genome: TATCTATAGCCTCTATACATTTCGTAGACT

guest75_global_0_1_261

Image 01

  • Creator: guest75
  • Population: 0 (Global)
  • Generation: 1
  • Total Fitness: 8
  • No. Votes: 2
  • Avg. Fitness 4
  • Created: 05/19/2019
  • Genome: TCTCGATTATAATCTAGACCGCGGTCCTGTCCT
  • Function:

    sin(numbers('yxy')) if numbers('yxr') if sin(numbers('yxy')) > numbers('yyx') else numbers('yxy') > numbers('yxr') if sin(numbers('yxy')) > numbers('yxy') else numbers('yyx') if numbers('yxy') > numbers('yxr') else sin(numbers('yxy')) else numbers('yxy') if sin(numbers('yxy')) if numbers('yxr') if sin(numbers('yxy')) > numbers('yyx') else numbers('yxy') > numbers('yxy') else numbers('yxr') > numbers('yxy') if numbers('yxr') > numbers('yyx') else sin(numbers('yxy')) else mod(numbers('yxy') if numbers('yxr') if sin(numbers('yxy')) > numbers('yxy') else numbers('yyx') if sin(numbers('yxy')) > numbers('yxr') else numbers('yxy') > sin(numbers('yxy')) else numbers('yyx') if numbers('yxy') > numbers('yxr') else sin(numbers('yxy')), numbers('yxr') if numbers('yxy') > numbers('yxy') if numbers('yxr') > numbers('yyx') else sin(numbers('yxy')) else sin(numbers('yxy')))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest203_0_2_235

Image 01

Genome: TCTCCATTATACTCTAGACCGCGGTCCTGTCCT

guest4634_0_2_256

Image 01

Genome: TAACATCGCGAGTAGGCTTAAACGCGGTCCTCAGAT

guest195_0_2_181

Image 01

Genome: TGGGGCCGATTATATTCTTGGCCGAGGTCGAAGCCT