• Creator: tquinlan
• Population: 0
• Generation: 0
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 05/19/2019
• Genome: CCACCGATTCCAACTGCACGCGGAGGTGAA
• Function:

  product(divide(gradient[0](product(2 *(numbers("yyy")), numbers("yyy"))), product(2 *(numbers("yyy")), numbers("yyy"))), gradient[0](product(2 *(numbers("yyy")), numbers("yyy"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.