• Creator: tquinlan
• Population: 0
• Generation: 1
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 05/19/2019
• Genome: CCACCGACTACAACTGCAATAACAATGGAA
• Function:

  product(divide(2 *(gradient[2](2 *(numbers("yyy")))), gradient[2](2 *(numbers("yyy")))), 2 *(gradient[2](2 *(numbers("yyy")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.