• Creator: robertjamesd220
• Population: 0
• Generation: 0
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 05/18/2021
• Genome: GGTATAAGAATAACTTCTGTGCACTGGTGG
• Function:

  logn(2 *(numbers('xyy'))) if logn(sin(logn(2 *(numbers('xyy'))))) > sin(logn(2 *(numbers('xyy')))) else 2 *(numbers('xyy'))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.