• Creator: robertjamesd220
• Population: 0
• Generation: 1
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 05/18/2021
• Genome: GTGCGAATAAGAATAACTATCATTTTAGCGAAT
• Function:

  logn(sin(logn(2 *(numbers('rep'))))) if sin(logn(2 *(numbers('rep')))) > logn(2 *(numbers('rep'))) else mod(logn(sin(logn(2 *(numbers('rep'))))), sin(logn(2 *(numbers('rep')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.