• Creator: robertjamesd220
• Population: 3
• Generation: 2
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 05/19/2021
• Genome: GGGTACACAACTAGAAAGACGCGGAGCTGG
• Function:

  sin(numbers("xyx")) if numbers("xyx") if 2 *(sin(numbers("xyx"))) > sin(numbers("xyx")) else gradient[2](2 *(sin(numbers("xyx")))) > 2 *(sin(numbers("xyx"))) else gradient[2](2 *(sin(numbers("xyx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.