• Creator: robertjamesd220
• Population: 3
• Generation: 3
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 05/19/2021
• Genome: GGGTACACCACTAGAAATACGCGGAGCTGG
• Function:

  numbers("yxx") if sin(numbers("yxx")) > 10 *(2 *(sin(numbers("yxx")))) else 2 *(sin(numbers("yxx"))) if 10 *(2 *(sin(numbers("yxx")))) > sin(numbers("yxx")) else 2 *(sin(numbers("yxx")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.