• Creator: robertjamesd220
• Population: 3
• Generation: 4
• Total Fitness: 9
• No. Votes: 1
• Avg. Fitness 9
• Created: 05/19/2021
• Genome: GGGTACACCACCCGCCAGAGCCGAAGCTGG
• Function:

  10 *(10 *(round(numbers("xyx"), numbers('xry')))) if round(numbers("xyx"), numbers('xry')) > round(numbers("xyx"), numbers('xry')) if numbers("xyx") > 10 *(10 *(round(numbers("xyx"), numbers('xry')))) else 10 *(round(numbers("xyx"), numbers('xry'))) else 10 *(round(numbers("xyx"), numbers('xry')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.