• Creator: robertjamesd220
• Population: 3
• Generation: 25
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 05/19/2021
• Genome: CCCCACTAAATTACCGAGTCTCCCGATGCG
• Function:

  product(sum(numbers('xyy') if 10 *(numbers("xyx")) > numbers("xyx") else gradient[0](10 *(numbers("xyx"))), gradient[0](10 *(numbers("xyx")))), 10 *(numbers("xyx")) if numbers("xyx") > numbers('xyy') else gradient[0](10 *(numbers("xyx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.