• Creator: robertjamesd220
• Population: 3
• Generation: 26
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 05/19/2021
• Genome: CCCCACTAAATTACCAAGACTGGAGACGCG
• Function:

  product(sum(numbers("xyx") if gradient[0](10 *(numbers("xyx"))) > 10 *(numbers("xyx")) else numbers('xyy'), gradient[0](10 *(numbers("xyx")))), numbers('xyy') if numbers("xyx") > 10 *(numbers("xyx")) else gradient[0](10 *(numbers("xyx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.