• Creator: robertjamesd220
• Population: 3
• Generation: 27
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 05/19/2021
• Genome: CCCCACTGTATTACCAAGCATGGAGTCGCG
• Function:

  product(sum(numbers("xyx") if 10 *(numbers("xyx")) > numbers("yxx") else gradient[0](10 *(numbers("xyx"))), gradient[0](10 *(numbers("xyx")))), gradient[0](10 *(numbers("xyx"))) if numbers("xyx") > numbers("yxx") else 10 *(numbers("xyx")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.