• Creator: guest79
• Population: 0
• Generation: 20
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 05/19/2019
• Genome: GCGGTGCATAAAACCCTAGGCCTCTGGTGTCTG
• Function:

  abs(10 *(max(numbers('xry'), numbers('rep')))) if 10 *(max(numbers('xry'), numbers('rep'))) > minus(abs(10 *(max(numbers('xry'), numbers('rep')))), 10 *(max(numbers('xry'), numbers('rep')))) else minus(abs(10 *(max(numbers('xry'), numbers('rep')))), 10 *(max(numbers('xry'), numbers('rep')))) if max(numbers('xry'), numbers('rep')) > 10 *(max(numbers('xry'), numbers('rep'))) else abs(10 *(max(numbers('xry'), numbers('rep'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.