• Creator: guest79
• Population: 0
• Generation: 19
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 05/19/2019
• Genome: GCGGTGCATAAAACCCTAGCCCCTCCGTGTCTG
• Function:

  minus(abs(10 *(max(numbers('yyx'), numbers('xyy')))), 10 *(max(numbers('yyx'), numbers('xyy')))) if 10 *(max(numbers('yyx'), numbers('xyy'))) > abs(10 *(max(numbers('yyx'), numbers('xyy')))) else 10 *(max(numbers('yyx'), numbers('xyy'))) if abs(10 *(max(numbers('yyx'), numbers('xyy')))) > max(numbers('yyx'), numbers('xyy')) else minus(abs(10 *(max(numbers('yyx'), numbers('xyy')))), 10 *(max(numbers('yyx'), numbers('xyy'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.