• Creator: guest79
• Population: 0
• Generation: 20
• Total Fitness: 10
• No. Votes: 1
• Avg. Fitness 10
• Created: 05/19/2019
• Genome: GCGGTGCATAAAACCCTAGCCCCTCCGTCTCAG
• Function:

  minus(abs(10 *(max(numbers('yyx'), numbers('xyy')))), 10 *(max(numbers('yyx'), numbers('xyy')))) if abs(10 *(max(numbers('yyx'), numbers('xyy')))) > 10 *(max(numbers('yyx'), numbers('xyy'))) else 10 *(max(numbers('yyx'), numbers('xyy'))) if minus(abs(10 *(max(numbers('yyx'), numbers('xyy')))), 10 *(max(numbers('yyx'), numbers('xyy')))) > max(numbers('yyx'), numbers('xyy')) else abs(10 *(max(numbers('yyx'), numbers('xyy'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.