header

genetic-algorithms.com

 

Inspect guest146_global_0_2_155

Parents

Mother

Image 01

sina12345_global_0_1_144

Genome: AACACGTAGAATTTTGAGCAGACGGATATTTCT

Father

Image 01

camrobjones_global_0_1_26

Genome: CACTGACATTGCCCTAAGTACCGTTGACACCAG

guest146_global_0_2_155

Image 01

  • Creator: guest146
  • Population: 0 (Global)
  • Generation: 2
  • Total Fitness: 6
  • No. Votes: 1
  • Avg. Fitness 6
  • Created: 05/19/2019
  • Genome: AACAGGTAGAATTTAGAGTAGAAGGATATTTCT
  • Function:

    square(tan(numbers("xyx") if numbers("xyx") if numbers("yxx") > numbers("xyx") else numbers('rrr') if numbers("yxx") > numbers("xyx") else numbers("xyx") > noise(numbers("xyx") if numbers("xyx") if numbers('rrr') > numbers("xyx") else numbers("yxx") > numbers("yxx") else numbers("xyx")) else numbers('rrr') if numbers("yxx") > numbers("xyx") else numbers("xyx")))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest195_0_3_62

Image 01

Genome: TGGATCAGGTAGAATTTAGAGTAGAAGGATATTTCA