header

genetic-algorithms.com

 

Inspect guest164_0_0_1

Parents

guest164_0_0_1 has no parents. It was generated at random.

guest164_0_0_1

Image 01

  • Creator: guest164
  • Population: 0
  • Generation: 0
  • Total Fitness: 10
  • No. Votes: 1
  • Avg. Fitness 10
  • Created: 05/19/2019
  • Genome: TTCTCACCTACTCTTTATTCTGCCGGTAAT
  • Function:

    round(numbers("yxx"), numbers('xyy')) if 2 *(round(numbers("yxx"), numbers('xyy'))) > 2 *(round(numbers("yxx"), numbers('xyy'))) if divide(2 *(round(numbers("yxx"), numbers('xyy'))), round(numbers("yxx"), numbers('xyy'))) > round(numbers("yxx"), numbers('xyy')) else numbers("yxx") else divide(2 *(round(numbers("yxx"), numbers('xyy'))), round(numbers("yxx"), numbers('xyy')))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest164_0_1_13

Image 01

Genome: CATGGTAAACCCACCTAGAATATGGGTGGG

guest164_0_1_19

Image 01

Genome: GTACGCTTACCTACTCCTTACATGTGTGTGGGA