• Creator: guest164
• Population: 0
• Generation: 1
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 05/19/2019
• Genome: CATGGTAAACCCACCTAGAATATGGGTGGG
• Function:

  minus(abs(product(10 *(numbers("xyx")), numbers("xyx"))) if numbers("xyx") > 10 *(numbers("xyx")) else product(10 *(numbers("xyx")), numbers("xyx")), abs(product(10 *(numbers("xyx")), numbers("xyx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.