header

genetic-algorithms.com

 

Inspect guest30_global_0_1_51

Parents

Mother

Image 01

global_global_0_0_77

Genome: GGCCTCTACATGGTCTAGATAAGATCCATT

Father

Image 01

global_global_0_0_86

Genome: CTCCTAATCTCGTTATACTCTGTGTTACAG

guest30_global_0_1_51

Image 01

  • Creator: guest30
  • Population: 0 (Global)
  • Generation: 1
  • Total Fitness: 13
  • No. Votes: 2
  • Avg. Fitness 6.5
  • Created: 05/19/2019
  • Genome: CCAGGCCTCTACGTGCTCTCGATAAGATCCATT
  • Function:

    product(numbers("per") if numbers("per") if numbers("xxr") > min(numbers('yxy'), numbers("per")) else numbers('yxy') > numbers('yxy') else min(numbers('yxy'), numbers("per")) if min(numbers('yxy'), numbers("per")) > numbers("per") if numbers("xxr") > numbers('yxy') else min(numbers('yxy'), numbers("per")) else min(min(numbers('yxy'), numbers("per")) if numbers("xxr") > numbers("per") else numbers('yxy') if min(numbers('yxy'), numbers("per")) > numbers('yxy') else numbers("per"), min(numbers('yxy'), numbers("per")) if numbers('yxy') > numbers("per") else numbers("xxr")), min(min(numbers('yxy'), numbers("per")) if numbers("per") > numbers('yxy') else numbers("per") if min(numbers('yxy'), numbers("per")) > numbers("xxr") else numbers('yxy'), numbers("per") if min(numbers('yxy'), numbers("per")) > numbers("xxr") else numbers('yxy')))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

sina12345_0_2_94

Image 01

Genome: TTAACGTAGAAGTTTGTGCTCTCGATAAGATCT

sina12345_0_2_85

Image 01

Genome: CAGCACTGACATTAAGTGCTCTCGATATGACACCAA

sina12345_0_2_65

Image 01

Genome: GGTTCGTCACCAGTCGGAAGAAGCCGTGTGGTCTAC

sina12345_0_2_37

Image 01

Genome: GATAAACACTTCCCCACCTCCATAAGGACT