• Creator: guest171
• Population: 0
• Generation: 0
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 05/19/2019
• Genome: TACCATTATACTAGACCAGTTCTAGAATGA
• Function:

  sin(numbers("yyy")) if numbers("yyy") if 2 *(sin(numbers("yyy"))) > numbers('rrr') else sin(numbers("yyy")) > minus(sin(numbers("yyy")) if numbers('rrr') > 2 *(sin(numbers("yyy"))) else numbers("yyy"), 2 *(sin(numbers("yyy")))) else 2 *(sin(numbers("yyy")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.