• Creator: guest171
• Population: 0
• Generation: 1
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 05/19/2019
• Genome: TGTTACCATTATACTAGGATGAACCTAAAATGA
• Function:

  2 *(tan(numbers('epe'))) if numbers("xxy") > numbers('epe') else tan(numbers('epe')) if 2 *(tan(numbers('epe'))) if tan(numbers('epe')) > minus(2 *(tan(numbers('epe'))) if tan(numbers('epe')) > numbers("xxy") else numbers('epe'), 2 *(tan(numbers('epe')))) else 2 *(tan(numbers('epe'))) if tan(numbers('epe')) > numbers("xxy") else numbers('epe') > 2 *(tan(numbers('epe'))) else minus(2 *(tan(numbers('epe'))) if numbers('epe') > numbers("xxy") else tan(numbers('epe')), 2 *(tan(numbers('epe'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.