header

genetic-algorithms.com

 

Inspect sina12345_global_0_1_193

Parents

Mother

Image 01

global_global_0_0_176

Genome: TCGACTATGCCCCGGGTCCGTCCGAGCCGG

Father

Image 01

global_global_0_0_50

Genome: CGATTATAAACTAGACCTCGGCATTGTCCT

sina12345_global_0_1_193

Image 01

  • Creator: sina12345
  • Population: 0 (Global)
  • Generation: 1
  • Total Fitness: 14
  • No. Votes: 2
  • Avg. Fitness 7
  • Created: 05/19/2019
  • Genome: TGATTTTAAAGTAGACCTCGGCCGAGCCGG
  • Function:

    numbers('xyy') if gradient[1](sin(numbers('xyy'))) > numbers('xyy') if sin(numbers('xyy')) > numbers('yxr') else gradient[1](sin(numbers('xyy'))) else sin(numbers('xyy')) if sin(numbers('xyy')) > numbers('xyy') if gradient[1](sin(numbers('xyy'))) > numbers('yxr') else sin(numbers('xyy')) else gradient[1](sin(numbers('xyy')))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

sina12345_0_2_123

Image 01

Genome: TAATGATTTTGGATCTGCATATTGCCGAGCCGG