• Creator: Jade
• Population: 0
• Generation: 7
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 12/06/2019
• Genome: GACTACTAACCCACTAATGCTTATATTGGTGTGTGG
• Function:

  2 *(noise(numbers('xyy'))) if 2 *(noise(numbers('xyy'))) if noise(numbers('xyy')) > noise(numbers('xyy')) if 2 *(noise(numbers('xyy'))) > product(2 *(noise(numbers('xyy'))), noise(numbers('xyy'))) else numbers('xyy') else product(2 *(noise(numbers('xyy'))), noise(numbers('xyy'))) > noise(numbers('xyy')) if numbers('xyy') > 2 *(noise(numbers('xyy'))) else product(2 *(noise(numbers('xyy'))), noise(numbers('xyy'))) else product(2 *(noise(numbers('xyy'))), noise(numbers('xyy')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.