• Creator: Jade
• Population: 0
• Generation: 8
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 12/06/2019
• Genome: ACCTAGCAACGCACTAATGCTTATATTGGC
• Function:

  10 *(sum(round(2 *(numbers("yxx")), numbers("yxx")), 2 *(numbers("yxx"))) if 2 *(numbers("yxx")) > numbers("yxx") else round(2 *(numbers("yxx")), numbers("yxx")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.