• Creator: Jade
• Population: 0
• Generation: 8
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 12/06/2019
• Genome: TACCCTTATACCCTTGCAAATTGTATTGAC
• Function:

  round(numbers("yyy"), numbers("yxx")) if divide(numbers("yyy") if 10 *(round(numbers("yyy"), numbers("yxx"))) > numbers("yxx") else round(numbers("yyy"), numbers("yxx")), 10 *(round(numbers("yyy"), numbers("yxx")))) > round(numbers("yyy"), numbers("yxx")) if numbers("yyy") > numbers("yxx") else 10 *(round(numbers("yyy"), numbers("yxx"))) else 10 *(round(numbers("yyy"), numbers("yxx")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.