• Creator: Jade
• Population: 0
• Generation: 8
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 12/06/2019
• Genome: TACCCTTATACCCTTGCAAATTGTATTGAC
• Function:

  10 *(round(numbers("yyy"), numbers("yxx"))) if round(numbers("yyy"), numbers("yxx")) > round(numbers("yyy"), numbers("yxx")) if 10 *(round(numbers("yyy"), numbers("yxx"))) > numbers("yxx") else numbers("yyy") else divide(round(numbers("yyy"), numbers("yxx")) if 10 *(round(numbers("yyy"), numbers("yxx"))) > numbers("yyy") else numbers("yxx"), 10 *(round(numbers("yyy"), numbers("yxx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.