header

genetic-algorithms.com

 

Inspect guest63_0_4_16

Parents

Mother

Image 01

guest63_0_3_19

Genome: CATATTCCGCGGGATAGCCACTGTCCGTCT

Father

Image 01

guest63_0_3_18

Genome: TGGTTGTCTAAGGTGCCCTTCTCCTATTTT

guest63_0_4_16

Image 01

  • Creator: guest63
  • Population: 0
  • Generation: 4
  • Total Fitness: 1
  • No. Votes: 1
  • Avg. Fitness 1
  • Created: 05/19/2019
  • Genome: GATATTCCGCGGGGTAGCTTCTCCTATTCT
  • Function:

    divide(exp(numbers('rep') if numbers('xry') > numbers('yyx') else numbers("yxx"), numbers('xry')), numbers('yyx') if numbers('rep') > numbers('xry') else numbers("yxx")) if gradient[0](divide(exp(numbers('rep') if numbers("yxx") > numbers('yyx') else numbers('xry'), numbers('xry')), numbers('xry') if numbers("yxx") > numbers('yyx') else numbers('rep'))) > numbers('yyx') if numbers('rep') > numbers('xry') else numbers("yxx") else exp(numbers('rep') if numbers("yxx") > numbers('yyx') else numbers('xry'), numbers('xry'))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest63_0_5_1

Image 01

Genome: GATATTCCGCGGGTTATCTTCTCCTCTCCT