header

genetic-algorithms.com

 

Inspect global_global_0_0_50

Parents

global_global_0_0_50 has no parents. It was generated at random.

global_global_0_0_50

Image 01

  • Creator: global
  • Population: 0 (Global)
  • Generation: 0
  • Total Fitness: 69
  • No. Votes: 8
  • Avg. Fitness 8.6
  • Created: 05/19/2019
  • Genome: CGATTATAAACTAGACCTCGGCATTGTCCT
  • Function:

    mod(2 *(sin(numbers('xyy'))) if numbers('xyy') if sin(numbers('xyy')) > numbers('yxr') else 2 *(sin(numbers('xyy'))) > numbers('xyy') else sin(numbers('xyy')), sin(numbers('xyy')) if 2 *(sin(numbers('xyy'))) > numbers('xyy') else numbers('yxr'))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

camrobjones_0_1_32

Image 01

Genome: TTGCGATTGGGAACTAGAGCTCGGAATTGTGCT

camrobjones_0_1_42

Image 01

Genome: CGATTCTGAACTAGACCTCGGCATTGCCAT

sina12345_0_1_132

Image 01

Genome: GACGGATTCTAGTTTTTTATCTTTCCTAATGCT

sina12345_0_1_200

Image 01

Genome: CCATTATCAAGCCCCACCCGGCATTGTCCT

guest75_0_1_261

Image 01

Genome: TCTCGATTATAATCTAGACCGCGGTCCTGTCCT

guest200_0_1_339

Image 01

Genome: AGGCAGTTATAAACTAGACCTCGGCATCGGCCTCTT

guest30_0_1_58

Image 01

Genome: CCCGATGATTTTAGACCTCGGGACTACCAT

guest30_0_1_97

Image 01

Genome: GTCAGATTATAACCTAGACCGCGGGATTGAGAA

guest52_0_1_123

Image 01

Genome: CCTGGATCCCGGAACCTGCCGACTCGTACTGCT

sina12345_0_1_143

Image 01

Genome: TATTGATTATAAACTAGATTATCTTCATTCGTG

sina12345_0_1_160

Image 01

Genome: TAATAGCGTCTCAAAGTACCTCGGCATTGTCGA

sina12345_0_1_193

Image 01

Genome: TGATTTTAAAGTAGACCTCGGCCGAGCCGG

sina12345_0_1_216

Image 01

Genome: GGTGATAAACACTTGCCCACCTATCATGGGACT

sina12345_0_1_218

Image 01

Genome: TGCGGCCCACAATGTGGAAGTGATGATCGTCGA

guest75_0_1_259

Image 01

Genome: TAATCTTTGATCGCCCCTCGGCAATCTGAG

guest195_0_1_298

Image 01

Genome: AGCGTATAAACTAGACCTCGGCAATCCAAA