• Creator: guest73
• Population: 0
• Generation: 2
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 05/19/2019
• Genome: CCCCTGCACCTGACTAGCCACGCGATGCAG
• Function:

  product(mean(sum(mean(2 *(numbers('xry')), numbers('xry')), 2 *(numbers('xry'))), mean(2 *(numbers('xry')), numbers('xry'))), sum(mean(2 *(numbers('xry')), numbers('xry')), 2 *(numbers('xry'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.