• Creator: guest79
• Population: 0
• Generation: 1
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 05/19/2019
• Genome: ATCTCTTTGACTCGCCATCAGTATTTTGCA
• Function:

  band pass(numbers("yxx") if round(numbers("yxx"), numbers("xyx")) if 2 *(round(numbers("yxx"), numbers("xyx"))) > numbers("xyx") else numbers("yxx") > round(numbers("yxx"), numbers("xyx")) else 2 *(round(numbers("yxx"), numbers("xyx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.